C8B cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

C8B cDNA ORF Clone, Human, untagged

C8B cDNA ORF Clone, Human, untagged

SPD-03701

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human complement component 8, beta polypeptide.
Target Information
Species Human
Target Name Complement C8B
Gene Abbr. C8B
Gene ID 732
Full Name complement C8 beta chain
Alias C82
Product Details
Description Full length Clone DNA of Human complement component 8, beta polypeptide.
NCBI Ref Seq BC130575
RefSeq ORF Size 1776 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.