C8A cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

C8A cDNA ORF Clone, Human, untagged

C8A cDNA ORF Clone, Human, untagged

SPD-03690

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human complement component 8, alpha polypeptide.
Target Information
Species Human
Target Name Complement C8A
Gene Abbr. C8A
Gene ID 731
Full Name complement C8 alpha chain
Product Details
Description Full length Clone DNA of Human complement component 8, alpha polypeptide.
NCBI Ref Seq BC132913
RefSeq ORF Size 1755 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.