C5AR1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

C5AR1 cDNA ORF Clone, Human, untagged

C5AR1 cDNA ORF Clone, Human, untagged

SPD-01869

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human complement component 5a receptor 1.
Target Information
Species Human
Target Name C5AR1
Gene Abbr. C5AR1
Gene ID 728
Full Name complement C5a receptor 1
Alias C5A, C5AR, C5R1, CD88
Product Details
Description Full length Clone DNA of Human complement component 5a receptor 1.
NCBI Ref Seq BC008982
RefSeq ORF Size 1053 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.05kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.