Online Inquiry
C5 cDNA ORF Clone, Human, C-FLAG tag
SPD-03637
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human complement component 5 with C terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Complement C5 |
| Gene Abbr. | C5 |
| Gene ID | 727 |
| Full Name | complement C5 |
| Alias | C5D, C5a, C5b, CPAMD4, ECLZB |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human complement component 5 with C terminal Flag tag. |
| NCBI Ref Seq | NM_001735.2 |
| RefSeq ORF Size | 5070 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 4266 G/A not causing the amino acid variation. |
| Vector | pCMV3-C-FLAG |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI (three restriction sites) + XbaI (6kb + 2.86kb + 1.68kb + 0.54kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.