Online Inquiry
C3 cDNA ORF Clone, Human, untagged
SPD-03636
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human complement component 3 DNA. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Complement C3 |
| Gene Abbr. | C3 |
| Gene ID | 718 |
| Full Name | complement C3 |
| Alias | AHUS5, ARMD9, ASP, C3a, C3b |
| Introduction | The complement factor C3 consists of an alpha and a beta chain. C3 is a central factor in the complement cascade. It is central to the alternative pathway that leads to the C3 convertase C3bBb. The classical mannose binding lectin activation pathway leads to the C3 convertase C4b2a. These convertases cleave C3 resulting in C3a and C3b. Further degradation leads to the formation of the alpha chain products C3d, C3g and C3c. C3 is an acute phase protein that is produced by a wide range of tissues, including renal epithelial cells and hepatocytes. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human complement component 3 DNA. |
| NCBI Ref Seq | NM_000064.2 |
| RefSeq ORF Size | 4992 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 2421G/C,2745T/C,3957G/C,4896C/T not causing the amino acid variation. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | HindIII + XbaI (6.1kb + 5.0kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.