C1R cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

C1R cDNA ORF Clone, Human, untagged

C1R cDNA ORF Clone, Human, untagged

SPD-01838

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human complement component 1, r subcomponent.
Target Information
Species Human
Target Name C1R
Gene Abbr. C1R
Gene ID 715
Full Name complement C1r
Alias EDSPD1
Product Details
Description Full length Clone DNA of Human complement component 1, r subcomponent.
NCBI Ref Seq NM_001733.4
RefSeq ORF Size 2118 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.