C1qc cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

C1qc cDNA ORF Clone, Mouse, untagged

C1qc cDNA ORF Clone, Mouse, untagged

SPD-01828

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse complement component 1, q subcomponent, C chain.
Target Information
Species Mouse
Target Name C1QC
Gene Abbr. C1qc
Gene ID 12262
Full Name complement component 1, q subcomponent, C chain
Alias AI385742, Adib, C1qg, Ciqc
Product Details
Description Full length Clone DNA of Mouse complement component 1, q subcomponent, C chain.
NCBI Ref Seq BC043945.1
RefSeq ORF Size 741 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.