C1QC cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

C1QC cDNA ORF Clone, Human, untagged

C1QC cDNA ORF Clone, Human, untagged

SPD-01817

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human complement component 1, q subcomponent, C chain.
Target Information
Species Human
Target Name C1QC
Gene Abbr. C1QC
Gene ID 714
Full Name complement C1q C chain
Alias C1Q-C, C1QG
Product Details
Description Full length Clone DNA of Human complement component 1, q subcomponent, C chain.
NCBI Ref Seq BC009016
RefSeq ORF Size 738 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites HindIII + XbaI (6.1kb + 0.74kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.