C1qa cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

C1qa cDNA ORF Clone, Mouse, untagged

C1qa cDNA ORF Clone, Mouse, untagged

SPD-01786

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse complement component 1, q subcomponent, alpha polypeptide.
Target Information
Species Mouse
Target Name C1QA
Gene Abbr. C1qa
Gene ID 12259
Full Name complement component 1, q subcomponent, alpha polypeptide
Alias AI255395, Adic, C1q
Product Details
Description Full length Clone DNA of Mouse complement component 1, q subcomponent, alpha polypeptide.
NCBI Ref Seq NM_007572.2
RefSeq ORF Size 738 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.