C1QA cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

C1QA cDNA ORF Clone, Human, untagged

C1QA cDNA ORF Clone, Human, untagged

SPD-01776

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human complement component 1, q subcomponent, A chain
Target Information
Species Human
Target Name C1QA
Gene Abbr. C1QA
Gene ID 712
Full Name complement C1q A chain
Product Details
Description Full length Clone DNA of Human complement component 1, q subcomponent, A chain
NCBI Ref Seq NM_015991.2
RefSeq ORF Size 738 bp
Vector pCMV3-untagged
Promoter Enhanced CMV mammalian cell promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.