Bub1 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Bub1 cDNA ORF Clone, Mouse, untagged

Bub1 cDNA ORF Clone, Mouse, untagged

SPD-01748

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse budding uninhibited by benzimidazoles 1 homolog, beta (S. cerevisiae).
Target Information
Species Mouse
Target Name BuB1
Gene Abbr. Bub1
Gene ID 12235
Full Name BUB1, mitotic checkpoint serine/threonine kinase
Alias AL022991, Bub1a, C80208, D2Xrf8, D2Xrf87
Product Details
Description Full length Clone DNA of Mouse budding uninhibited by benzimidazoles 1 homolog, beta (S. cerevisiae).
NCBI Ref Seq NM_009772.2
RefSeq ORF Size 3177 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.