BuB1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

BuB1 cDNA ORF Clone, Human, untagged

BuB1 cDNA ORF Clone, Human, untagged

SPD-01738

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human BUB1 budding uninhibited by benzimidazoles 1 homolog.
Target Information
Species Human
Target Name BuB1
Gene Abbr. BuB1
Gene ID 699
Full Name BUB1 mitotic checkpoint serine/threonine kinase
Alias BUB1A, BUB1L, hBUB1
Product Details
Description Full length Clone DNA of Human BUB1 budding uninhibited by benzimidazoles 1 homolog.
NCBI Ref Seq NM_004336.2
RefSeq ORF Size 3258 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + NotI (6.1kb + 3.26kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.