Online Inquiry
BTRC Knockout Cell Line
SPL-00731
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 7bp deletion |
| Target Information | |
|---|---|
| Target Name | β-TrCP |
| Gene Abbr. | BTRC |
| Gene ID | 8945 |
| Full Name | beta-transducin repeat containing E3 ubiquitin protein ligase |
| Alias | BETA-TRCP, FBW1A, FBXW1, FBXW1A, FWD1 |
| Species | Human |
| Genomic Locus | chr10:101521664 |
| Transcript | NM_033637 |
| WT Expression Level | 14.41 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbws class; in addition to an F-box, this protein contains multiple WD-40 repeats. The encoded protein mediates degradation of CD4 via its interaction with HIV-1 Vpu. It has also been shown to ubiquitinate phosphorylated NFKBIA (nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha), targeting it for degradation and thus activating nuclear factor kappa-B. Alternatively spliced transcript variants have been described. A related pseudogene exists in chromosome 6. [provided by RefSeq, Mar 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of BTRC. |
| Description | 7bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GTATGATTGTGCCCAAGCAA |
| PCR Primer |
Forward: CTGTGGTTTTCCACGTAATTGCTAA Reverse: CATGTTGGTAATGACACATTTGGGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.