BTK cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

BTK cDNA ORF Clone, Human, untagged

BTK cDNA ORF Clone, Human, untagged

SPD-01728

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human Bruton agammaglobulinemia tyrosine kinase.
Target Information
Species Human
Target Name Btk
Gene Abbr. BTK
Gene ID 695
Full Name Bruton tyrosine kinase
Alias AGMX1, AT, ATK, BPK, IGHD3
Introduction Bruton's tyrosine kinase (Btk) is a member of the Btk/Tec family of cytoplasmic tyrosine kinases. Like other Btk family members, it contains a pleckstrin homology (PH) domain and Src homology SH3 and SH2 domains. Btk plays an important role in B cell development. Activation of B cells by various ligands is accompanied by Btk membrane translocation mediated by its PH domain binding to phosphatidylinositol-3,4,5-trisphosphate. The membrane-localized Btk is active and associated with transient phosphorylation of two tyrosine residues, Tyr551 and Tyr223. Tyr551 in the activation loop is transphosphorylated by the Src family tyrosine kinases, leading to autophosphorylation at Tyr223 within the SH3 domain, which is necessary for full activation. The activation of Btk is negatively regulated by PKCβ through phosphorylation of Btk at Ser180, which results in reduced membrane recruitment, transphosphorylation, and subsequent activation. The PKC inhibitory signal is likely to be a key determinant of the B cell receptor signaling threshold to maintain optimal Btk activity.
Product Details
Description Full length Clone DNA of Human Bruton agammaglobulinemia tyrosine kinase.
NCBI Ref Seq NM_000061.2
RefSeq ORF Size 1980 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1899C>T not causing the amino acid variation.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + NotI (6.1kb + 1.98kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.