BRDT Knockout Cell Line - CD BioSciences

service-banner

BRDT Knockout Cell Line

BRDT Knockout Cell Line

SPL-00719

Size Price
1 Unit Online Inquiry
Description
2bp deletion
Target Information
Target Name BRDT
Gene Abbr. BRDT
Gene ID 676
Full Name bromodomain testis associated
Alias BRD6, CT9, SPGF21
Species Human
Genomic Locus chr1:91977319
Transcript NM_001242807
WT Expression Level 0.70 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction BRDT is similar to the RING3 protein family. It possesses 2 bromodomain motifs and a PEST sequence (a cluster of proline, glutamic acid, serine, and threonine residues), characteristic of proteins that undergo rapid intracellular degradation. The bromodomain is found in proteins that regulate transcription. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jun 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of BRDT.
Description 2bp deletion
Parental Cell Line C631
Guide RNA Sequence CCCAAAGCATTAACGTCAAC
PCR Primer Forward: TTTTGCCAGATTCTCAGCAACAATA
Reverse: GGACATGTTCAAGTGGAAGAAAACA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.