Online Inquiry
BRD8 Knockout Cell Line
SPL-00714
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 7bp deletion |
| Target Information | |
|---|---|
| Target Name | BRD8 |
| Gene Abbr. | BRD8 |
| Gene ID | 10902 |
| Full Name | bromodomain containing 8 |
| Alias | SMAP, SMAP2, p120 |
| Species | Human |
| Genomic Locus | chr5:138177606 |
| Transcript | NM_001164326 |
| WT Expression Level | 82.64 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene interacts with thyroid hormone receptor in a ligand-dependent manner and enhances thyroid hormone-dependent activation from thyroid response elements. This protein contains a bromodomain and is thought to be a nuclear receptor coactivator. Multiple alternatively spliced transcript variants that encode distinct isoforms have been identified. [provided by RefSeq, Jul 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of BRD8. |
| Description | 7bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TAAACATAGCTTCTCTCGGA |
| PCR Primer |
Forward: AGAAAAAGAAAAGAAAGTCTACTTACAGC Reverse: TCACTTGGAGAGGTGAAAATCAAGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.