Online Inquiry
BRD7 Knockout Cell Line
SPL-00713
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | BRD7 |
| Gene Abbr. | BRD7 |
| Gene ID | 29117 |
| Full Name | bromodomain containing 7 |
| Alias | BP75, CELTIX1, NAG4 |
| Species | Human |
| Genomic Locus | chr16:50368222 |
| Transcript | NM_013263 |
| WT Expression Level | 104.95 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a protein which is a member of the bromodomain-containing protein family. The product of this gene has been identified as a component of one form of the SWI/SNF chromatin remodeling complex, and as a protein which interacts with p53 and is required for p53-dependent oncogene-induced senescence which prevents tumor growth. Pseudogenes have been described on chromosomes 2, 3, 6, 13 and 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of BRD7. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CGAGCTGCCCGTGGAGAGTT |
| PCR Primer |
Forward: CGTTTGTTTTCCCCAGATACAAAGA Reverse: CGATTTTAATCGACGCGCTTTCC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.