Online Inquiry
BRD4 Knockout Cell Line
SPL-00710
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp insertion |
| Target Information | |
|---|---|
| Target Name | BRD4 |
| Gene Abbr. | BRD4 |
| Gene ID | 23476 |
| Full Name | bromodomain containing 4 |
| Alias | CAP, HUNK1, HUNKI, MCAP |
| Species | Human |
| Genomic Locus | chr19:15273059 |
| Transcript | NM_014299 |
| WT Expression Level | 26.30 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is homologous to the murine protein MCAP, which associates with chromosomes during mitosis, and to the human RING3 protein, a serine/threonine kinase. Each of these proteins contains two bromodomains, a conserved sequence motif which may be involved in chromatin targeting. This gene has been implicated as the chromosome 19 target of translocation t(15;19)(q13;p13.1), which defines an upper respiratory tract carcinoma in young people. Two alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of BRD4. |
| Description | 2bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGATTTCTCAATCTCGTCCC |
| PCR Primer |
Forward: AAACTGGTGTTTCCATAGTGTCTTG Reverse: CAGAGGGACTTGTCATTCTGAGC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.