Online Inquiry
BRD2 Knockout Cell Line
SPL-00708
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 4bp deletion |
| Target Information | |
|---|---|
| Target Name | BRD2 |
| Gene Abbr. | BRD2 |
| Gene ID | 6046 |
| Full Name | bromodomain containing 2 |
| Alias | BRD2-IT1, D6S113E, FSH, FSRG1, NAT |
| Species | Human |
| Genomic Locus | chr6:32974561 |
| Transcript | NM_001199456 |
| WT Expression Level | 163.61 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a transcriptional regulator that belongs to the BET (bromodomains and extra terminal domain) family of proteins. This protein associates with transcription complexes and with acetylated chromatin during mitosis, and it selectively binds to the acetylated lysine-12 residue of histone H4 via its two bromodomains. The gene maps to the major histocompatability complex (MHC) class II region on chromosome 6p21.3, but sequence comparison suggests that the protein is not involved in the immune response. This gene has been implicated in juvenile myoclonic epilepsy, a common form of epilepsy that becomes apparent in adolescence. Multiple alternatively spliced variants have been described for this gene. [provided by RefSeq, Dec 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of BRD2. |
| Description | 4bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGAGAGCCCCACAATGGCTT |
| PCR Primer |
Forward: CGATATTGCCCTAATTTTGTTCCCA Reverse: TCACTACCTTGTGTAGGTATTGCAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.