Online Inquiry
BRCA1 cDNA ORF Clone, Human, N-FLAG tag
SPD-01708
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human BRCA1, DNA repair associated |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | BRCA1 |
| Gene Abbr. | BRCA1 |
| Gene ID | 672 |
| Full Name | BRCA1 DNA repair associated |
| Alias | BRCAI, BRCC1, BROVCA1, FANCS, IRIS |
| Introduction | The breast cancer susceptibility proteins BRCA1 and BRCA2 are frequently mutated in cases of hereditary breast and ovarian cancers and have roles in multiple processes related to DNA damage, repair, cell cycle progression, transcription, ubiquitination, and apoptosis. BRCA2 has been shown to be required for localization of Rad51 to sites of double stranded breaks (DSBs) in DNA, and cells lacking BRCA1 and BRCA2 cannot repair DSBs through the Rad51-dependent process of homologous recombination. Numerous DNA damage-induced phosphorylation sites on BRCA1 have been identified, including Ser988, 1189, 1387, 1423, 1457, 1524, and 1542, and kinases activated in a cell cycle-dependent manner, including Aurora A and CDK2, can also phosphorylate BRCA1 at Ser308 and Ser1497, respectively. Cell cycle-dependent phosphorylation of BRCA2 at Ser3291 by CDKs has been proposed as a mechanism to switch off HR as cells progress beyond S-phase by blocking the carboxy terminal Rad51 binding site. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human BRCA1, DNA repair associated |
| NCBI Ref Seq | BC072418 |
| RefSeq ORF Size | 2139 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-N-FLAG |
| Promoter | Enhanced CMV mammalian cell promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Restriction Sites | KpnI + NotI (6kb + 2.14kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.