Online Inquiry
BPTF Knockout Cell Line
SPL-00675
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 16bp deletion |
| Target Information | |
|---|---|
| Target Name | BPTF |
| Gene Abbr. | BPTF |
| Gene ID | 2186 |
| Full Name | bromodomain PHD finger transcription factor |
| Alias | FAC1, FALZ, NEDDFL, NURF301 |
| Species | Human |
| Genomic Locus | chr17:67854074 |
| Transcript | NM_004459 |
| WT Expression Level | 56.80 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene was identified by the reactivity of its encoded protein to a monoclonal antibody prepared against brain homogenates from patients with Alzheimer's disease. Analysis of the original protein (fetal Alz-50 reactive clone 1, or FAC1), identified as an 810 aa protein containing a DNA-binding domain and a zinc finger motif, suggested it might play a role in the regulation of transcription. High levels of FAC1 were detected in fetal brain and in patients with neurodegenerative diseases. The protein encoded by this gene is actually much larger than originally thought, and it also contains a C-terminal bromodomain characteristic of proteins that regulate transcription during proliferation. The encoded protein is highly similar to the largest subunit of the Drosophila NURF (nucleosome remodeling factor) complex. In Drosophila, the NURF complex, which catalyzes nucleosome sliding on DNA and interacts with sequence-specific transcription factors, is necessary for the chromatin remodeling required for transcription. Two alternative transcripts encoding different isoforms have been described completely. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 16bp deletion in a coding exon of BPTF. |
| Description | 16bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TACGAGGTACTGCGGAACTT |
| PCR Primer |
Forward: AATGTATTGATTTGTAATGATGTCACG Reverse: ACAGTGTGGAATTAACGCTATCTTTC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.