Online Inquiry
BPGM Knockout Cell Line
SPL-00672
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 11bp deletion |
| Target Information | |
|---|---|
| Target Name | BPGM |
| Gene Abbr. | BPGM |
| Gene ID | 669 |
| Full Name | bisphosphoglycerate mutase |
| Alias | DPGM, ECYT8 |
| Species | Human |
| Genomic Locus | chr7:134661687 |
| Transcript | NM_001724 |
| WT Expression Level | 11.70 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | 2,3-diphosphoglycerate (2,3-DPG) is a small molecule found at high concentrations in red blood cells where it binds to and decreases the oxygen affinity of hemoglobin. This gene encodes a multifunctional enzyme that catalyzes 2,3-DPG synthesis via its synthetase activity, and 2,3-DPG degradation via its phosphatase activity. The enzyme also has phosphoglycerate phosphomutase activity. Deficiency of this enzyme increases the affinity of cells for oxygen. Mutations in this gene result in hemolytic anemia. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of BPGM. |
| Description | 11bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTGTGTGAATGGACCGATTA |
| PCR Primer |
Forward: GCTGTCCTTGAATATTAGCCCATTT Reverse: TTCTTCACCATGATTCAAAGCCATC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.