BMX cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

BMX cDNA ORF Clone, Human, untagged

BMX cDNA ORF Clone, Human, untagged

SPD-05396

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human BMX non-receptor tyrosine kinase transcript variant 2.
Target Information
Species Human
Target Name Etk/BMX
Gene Abbr. BMX
Gene ID 660
Full Name BMX non-receptor tyrosine kinase
Alias ETK, PSCTK2, PSCTK3
Introduction This gene encodes a member of the bone morphogenetic protein (BMP) receptor family of transmembrane serine/threonine kinases. The ligands of this receptor are BMPs, which are members of the TGF-beta superfamily. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of two different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. Mutations in this gene have been associated with primary pulmonary hypertension, both familial and fenfluramine-associated, and with pulmonary venoocclusive disease. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Human BMX non-receptor tyrosine kinase transcript variant 2.
NCBI Ref Seq NM_001721.6
RefSeq ORF Size 2028 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + ApaI (6.1kb + 2.03kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.