Online Inquiry
BMX cDNA ORF Clone, Human, C-HA tag
SPD-05390
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human BMX non-receptor tyrosine kinase transcript variant 2 with C terminal HA tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Etk/BMX |
Gene Abbr. | BMX |
Gene ID | 660 |
Full Name | BMX non-receptor tyrosine kinase |
Alias | ETK, PSCTK2, PSCTK3 |
Introduction | This gene encodes a member of the bone morphogenetic protein (BMP) receptor family of transmembrane serine/threonine kinases. The ligands of this receptor are BMPs, which are members of the TGF-beta superfamily. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of two different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. Mutations in this gene have been associated with primary pulmonary hypertension, both familial and fenfluramine-associated, and with pulmonary venoocclusive disease. [provided by RefSeq] |
Product Details | |
---|---|
Description | Full length Clone DNA of Human BMX non-receptor tyrosine kinase transcript variant 2 with C terminal HA tag. |
NCBI Ref Seq | NM_001721.6 |
RefSeq ORF Size | 2070 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Restriction Sites | KpnI + NotI (6kb + 2.07kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.