Online Inquiry
BMP4 Knockout Cell Line
SPL-00664
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 10bp deletion |
| Target Information | |
|---|---|
| Target Name | BMP-4 |
| Gene Abbr. | BMP4 |
| Gene ID | 652 |
| Full Name | bone morphogenetic protein 4 |
| Alias | BMP2B, BMP2B1, MCOPS6, OFC11, ZYME |
| Species | Human |
| Genomic Locus | chr14:53951971 |
| Transcript | NM_130851 |
| WT Expression Level | 11.28 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates heart development and adipogenesis. Mutations in this gene are associated with orofacial cleft and microphthalmia in human patients. The encoded protein may also be involved in the pathology of multiple cardiovascular diseases and human cancers. [provided by RefSeq, Jul 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of BMP4. |
| Description | 10bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CCGCATGTAGTCCGGAATGA |
| PCR Primer |
Forward: TTTGATGTAACCCGAACTCTTCTTC Reverse: ATGCTAGTTTGATACCTGAGACGG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.