Online Inquiry
BMI1 Knockout Cell Line
SPL-00660
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
1bp deletion |
Target Information | |
---|---|
Target Name | Bmi1 |
Gene Abbr. | BMI1 |
Gene ID | 648 |
Full Name | BMI1 proto-oncogene, polycomb ring finger |
Alias | FLVI2/BMI1, PCGF4, RNF51, flvi-2/bmi-1 |
Species | Human |
Genomic Locus | chr10:22326897 |
Transcript | NM_005180 |
WT Expression Level | 83.67 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a ring finger protein that is major component of the polycomb group complex 1 (PRC1). This complex functions through chromatin remodeling as an essential epigenetic repressor of multiple regulatory genes involved in embryonic development and self-renewal in somatic stem cells. This protein also plays a central role in DNA damage repair. This gene is an oncogene and aberrant expression is associated with numerous cancers and is associated with resistance to certain chemotherapies. A pseudogene of this gene is found on chromosome X. Read-through transcription also exists between this gene and the upstream COMM domain containing 3 (COMMD3) gene. [provided by RefSeq, Sep 2015]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp deletion in a coding exon of BMI1. |
Description | 1bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | AACGTGTATTGTTCGTTACC |
PCR Primer |
Forward: GAAGGCATTTTCTTCTCTTGCATCT Reverse: CTGTGAAGAAATAAAGAGGGTTGCC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.