Blnk cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Blnk cDNA ORF Clone, Mouse, untagged

Blnk cDNA ORF Clone, Mouse, untagged

SPD-01684

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse B cell linker.
Target Information
Species Mouse
Target Name BLNK
Gene Abbr. Blnk
Gene ID 17060
Full Name B cell linker
Alias BA, BASH, BC, BL, Bca
Introduction B cell linker protein (BLNK), also known as SLP-65 or BASH, is an adaptor molecule that plays key roles in B cell activation and B cell antigen receptor (BCR) engagement. BLNK acts at the interface between BCR-associated Syk and downstream signaling cascades. BLNK has multiple SH2 binding motifs (YXXP) at its amino terminus and an SH2 domain at its carboxy terminus. After BCR ligation, BLNK is phosphorylated by Syk at multiple YXXP motifs including Tyr72, Tyr84, Tyr96, and Tyr178. These phosphorylated motifs provide docking sites for signaling molecules, such as BTK, PLCγ, and Vav. These signaling molecules bind to BLNK through their SH2 domains and together activate downstream signaling pathways. Through its SH2 domain, BLNK can also interact with tyrosine-phosphorylated targets, such as HPK1, thereby recruiting them to the BCR complex for signaling.
Product Details
Description Full length Clone DNA of Mouse B cell linker.
NCBI Ref Seq NM_008528.4
RefSeq ORF Size 1374 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 156C/T, 585C/T, 1290C/T not causing the amino acid variation.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.37kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.