Online Inquiry
Blnk cDNA ORF Clone, Mouse, N-His tag
SPD-01681
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse B cell linker with N terminal His tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | BLNK |
| Gene Abbr. | Blnk |
| Gene ID | 17060 |
| Full Name | B cell linker |
| Alias | BA, BASH, BC, BL, Bca |
| Introduction | B cell linker protein (BLNK), also known as SLP-65 or BASH, is an adaptor molecule that plays key roles in B cell activation and B cell antigen receptor (BCR) engagement. BLNK acts at the interface between BCR-associated Syk and downstream signaling cascades. BLNK has multiple SH2 binding motifs (YXXP) at its amino terminus and an SH2 domain at its carboxy terminus. After BCR ligation, BLNK is phosphorylated by Syk at multiple YXXP motifs including Tyr72, Tyr84, Tyr96, and Tyr178. These phosphorylated motifs provide docking sites for signaling molecules, such as BTK, PLCγ, and Vav. These signaling molecules bind to BLNK through their SH2 domains and together activate downstream signaling pathways. Through its SH2 domain, BLNK can also interact with tyrosine-phosphorylated targets, such as HPK1, thereby recruiting them to the BCR complex for signaling. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse B cell linker with N terminal His tag. |
| NCBI Ref Seq | NM_008528.4 |
| RefSeq ORF Size | 1374 bp |
| Vector | pCMV3-N-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.