Blk cDNA ORF Clone, Mouse, C-His tag - CD BioSciences

service-banner

Blk cDNA ORF Clone, Mouse, C-His tag

Blk cDNA ORF Clone, Mouse, C-His tag

SPD-01657

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse B lymphoid kinase with C terminal His tag.
Target Information
Species Mouse
Target Name Blk
Gene Abbr. Blk
Gene ID 12143
Full Name B lymphoid kinase
Introduction Blk is a Src family protein tyrosine kinase expressed in all stages of B cell development. Activation of B cells by various ligands is accompanied by activation of Blk. It has been suggested that Blk is involved in the control of B cell differentiation and proliferation. Blk transcripts have also been detected in human thymocytes, but not in mature T cells, implicating that Blk may play an important role in thymopoiesis. Blk function may be redundant, however, as mice that do not express Blk are not impaired with respect to B cell development and immune response.
Product Details
Description Full length Clone DNA of Mouse B lymphoid kinase with C terminal His tag.
NCBI Ref Seq NM_007549.2
RefSeq ORF Size 1500 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.