Online Inquiry
BLK cDNA ORF Clone, Human, N-His tag
SPD-01672
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human B lymphoid tyrosine kinase with N terminal His tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Blk |
Gene Abbr. | BLK |
Gene ID | 640 |
Full Name | BLK proto-oncogene, Src family tyrosine kinase |
Alias | MODY11 |
Introduction | Blk is a Src family protein tyrosine kinase expressed in all stages of B cell development. Activation of B cells by various ligands is accompanied by activation of Blk. It has been suggested that Blk is involved in the control of B cell differentiation and proliferation. Blk transcripts have also been detected in human thymocytes, but not in mature T cells, implicating that Blk may play an important role in thymopoiesis. Blk function may be redundant, however, as mice that do not express Blk are not impaired with respect to B cell development and immune response. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human B lymphoid tyrosine kinase with N terminal His tag. |
NCBI Ref Seq | NM_001715.2 |
RefSeq ORF Size | 1518 bp |
Vector | pCMV3-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.