BLK cDNA ORF Clone, Human, C-Myc tag - CD BioSciences

service-banner

BLK cDNA ORF Clone, Human, C-Myc tag

BLK cDNA ORF Clone, Human, C-Myc tag

SPD-01668

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human B lymphoid tyrosine kinase with C terminal Myc tag.
Target Information
Species Human
Target Name Blk
Gene Abbr. BLK
Gene ID 640
Full Name BLK proto-oncogene, Src family tyrosine kinase
Alias MODY11
Introduction Blk is a Src family protein tyrosine kinase expressed in all stages of B cell development. Activation of B cells by various ligands is accompanied by activation of Blk. It has been suggested that Blk is involved in the control of B cell differentiation and proliferation. Blk transcripts have also been detected in human thymocytes, but not in mature T cells, implicating that Blk may play an important role in thymopoiesis. Blk function may be redundant, however, as mice that do not express Blk are not impaired with respect to B cell development and immune response.
Product Details
Description Full length Clone DNA of Human B lymphoid tyrosine kinase with C terminal Myc tag.
NCBI Ref Seq NM_001715.2
RefSeq ORF Size 1563 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 843T/C not causing the amino acid variation.
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + XbaI (6kb + 1.56kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.