BIRC5 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

BIRC5 cDNA ORF Clone, Human, untagged

BIRC5 cDNA ORF Clone, Human, untagged

SPD-01625

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human baculoviral IAP repeat-containing 5, transcript variant 1.
Target Information
Species Human
Target Name BIRC5
Gene Abbr. BIRC5
Gene ID 332
Full Name baculoviral IAP repeat containing 5
Alias API4, EPR-1
Product Details
Description Full length Clone DNA of Human baculoviral IAP repeat-containing 5, transcript variant 1.
NCBI Ref Seq NM_001168.2
RefSeq ORF Size 429 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.43kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.