Online Inquiry
BIRC3 Knockout Cell Line
SPL-00645
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
17bp deletion |
Target Information | |
---|---|
Target Name | c-IAP2 |
Gene Abbr. | BIRC3 |
Gene ID | 330 |
Full Name | baculoviral IAP repeat containing 3 |
Alias | AIP1, API2, CIAP2, HAIP1, HIAP1 |
Species | Human |
Genomic Locus | chr11:102328108 |
Transcript | NM_001165 |
WT Expression Level | 0.56 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a member of the IAP family of proteins that inhibit apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. The encoded protein inhibits apoptosis induced by serum deprivation but does not affect apoptosis resulting from exposure to menadione, a potent inducer of free radicals. It contains 3 baculovirus IAP repeats and a ring finger domain. Transcript variants encoding the same isoform have been identified. [provided by RefSeq, Aug 2011]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 17bp deletion in a coding exon of BIRC3. |
Description | 17bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | TTCAAGTAGATGAGGGTAAC |
PCR Primer |
Forward: GCAAACAACCAGATTTGAAATGGAA Reverse: AAGTGTCATTATCAGGAGACTACCA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.