Birc3 cDNA ORF Clone, Mouse, N-His tag - CD BioSciences

service-banner

Birc3 cDNA ORF Clone, Mouse, N-His tag

Birc3 cDNA ORF Clone, Mouse, N-His tag

SPD-03390

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse baculoviral IAP repeat-containing 3 with N terminal His tag.
Target Information
Species Mouse
Target Name c-IAP2
Gene Abbr. Birc3
Gene ID 11796
Full Name baculoviral IAP repeat-containing 3
Alias A, AW107670, Api1, Api2, Birc2
Introduction The inhibitor of apoptosis protein (IAP) family consists of an evolutionarily conserved group of apoptosis inhibitors containing a conserved 70 amino acid BIR (baculovirus inhibitor repeat) domain. Human members of this family include c-IAP1, c-IAP2, XIAP, survivin, livin, and NAIP. Overexpression of IAP family members, particularly survivin and livin, in cancer cell lines and primary tumors suggests an important role for these proteins in cancer progression. In general, the IAP proteins function through direct interactions to inhibit the activity of several caspases, including caspase-3, caspase-7, and caspase-9. In addition, binding of IAP family members to the mitochondrial protein Smac blocks their interaction with caspase-9, thereby allowing the processing and activation of the caspase.
Product Details
Description Full length Clone DNA of Mouse baculoviral IAP repeat-containing 3 with N terminal His tag.
NCBI Ref Seq NM_007464.3
RefSeq ORF Size 1809 bp
Vector pCMV3-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.