BIRC2 cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

BIRC2 cDNA ORF Clone, Human, N-FLAG tag

BIRC2 cDNA ORF Clone, Human, N-FLAG tag

SPD-03379

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human baculoviral IAP repeat-containing 2 with N terminal Flag tag.
Target Information
Species Human
Target Name c-IAP1
Gene Abbr. BIRC2
Gene ID 329
Full Name baculoviral IAP repeat containing 2
Alias API1, HIAP2, Hiap-2, MIHB, RNF48
Introduction The inhibitor of apoptosis protein (IAP) family consists of an evolutionarily conserved group of apoptosis inhibitors containing a conserved 70 amino acid BIR (baculovirus inhibitor repeat) domain. Human members of this family include c-IAP1, c-IAP2, XIAP, survivin, livin, and NAIP. Overexpression of IAP family members, particularly survivin and livin, in cancer cell lines and primary tumors suggests an important role for these proteins in cancer progression. In general, the IAP proteins function through direct interactions to inhibit the activity of several caspases, including caspase-3, caspase-7, and caspase-9. In addition, binding of IAP family members to the mitochondrial protein Smac blocks their interaction with caspase-9, thereby allowing the processing and activation of the caspase.
Product Details
Description Full length Clone DNA of Human baculoviral IAP repeat-containing 2 with N terminal Flag tag.
NCBI Ref Seq NM_001166.4
RefSeq ORF Size 1896 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 327A/G not causing the amino acid variation.
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites HindIII + NotI (6kb + 1.9kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.