Online Inquiry
BID cDNA ORF Clone, Human, N-Myc tag
SPD-01602
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human BH3 interacting domain death agonist with N terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Bid |
| Gene Abbr. | BID |
| Gene ID | 637 |
| Full Name | BH3 interacting domain death agonist |
| Alias | FP497 |
| Introduction | Bid is a pro-apoptotic “BH3 domain-only” member of the Bcl-2 family originally discovered to interact with both the anti-apoptotic family member Bcl-2 and the pro-apoptotic protein Bax. Bid is normally localized in the cytosolic fraction of cells as an inactive precursor and is cleaved at Asp60 by caspase-8 during Fas signaling, leading to translocation of the carboxyl terminal p15 fragment (tBid) to the mitochondrial outer membrane. Translocation of Bid is associated with release of cytochrome c from the mitochondria, leading to complex formation with Apaf-1 and caspase-9 and resulting in caspase-9 activation. Thus, Bid relays an apoptotic signal from the cell surface to the mitochondria triggering caspase activation. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human BH3 interacting domain death agonist with N terminal Myc tag. |
| NCBI Ref Seq | NM_001196.2 |
| RefSeq ORF Size | 588 bp |
| Vector | pCMV3-N-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.