Online Inquiry
Becn1 cDNA ORF Clone, Mouse, C-His tag
SPD-01570
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse beclin 1, autophagy related with C terminal His tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | Beclin-1 |
Gene Abbr. | Becn1 |
Gene ID | 56208 |
Full Name | beclin 1, autophagy related |
Alias | Atg, Atg6 |
Introduction | Autophagy is a catabolic process for the autophagosomic-lysosomal degradation of proteins activated in response to nutrient deprivation and in neurodegenerative conditions. One of the proteins critical to this process is Beclin-1, the mammalian orthologue of the yeast autophagy protein Apg6/Vps30. Beclin-1 can complement defects in yeast autophagy caused by loss of Apg6 and can also stimulate autophagy when overexpressed in mammalian cells. Mammalian Beclin-1 was originally isolated in a yeast two-hybrid screen for Bcl-2 interacting proteins and has been shown to interact with Bcl-2 and Bcl-xL, but not with Bax or Bak. While Beclin-1 is generally ubiquitously expressed, research studies have shown it is monoallelically deleted in 40-75% of sporadic human breast and ovarian cancers. Beclin-1 is localized within cytoplasmic structures including the mitochondria, although overexpression of Beclin-1 reveals some nuclear staining and CRM1-dependent nuclear export. Investigators have demonstrated that Beclin-1-/- mice die early in embryogenesis and Beclin-1-/+ mice have a high incidence of spontaneous tumors. Stem cells from the null mice demonstrate an altered autophagic response, although responses to apoptosis appeared normal. Researchers have also found that overexpression of Beclin-1 in virally infected neurons in vivo resulted in significant protection against Sindbis virus-induced disease and neuronal apoptosis. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse beclin 1, autophagy related with C terminal His tag. |
NCBI Ref Seq | NM_019584.3 |
RefSeq ORF Size | 1347 bp |
Vector | pCMV3-C-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.