BECN1 cDNA ORF Clone, Human, C-HA tag - CD BioSciences

service-banner

BECN1 cDNA ORF Clone, Human, C-HA tag

BECN1 cDNA ORF Clone, Human, C-HA tag

SPD-01582

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human beclin 1, autophagy related with C terminal HA tag.
Target Information
Species Human
Target Name Beclin-1
Gene Abbr. BECN1
Gene ID 8678
Full Name beclin 1
Alias ATG6, VPS30, beclin1
Introduction Autophagy is a catabolic process for the autophagosomic-lysosomal degradation of proteins activated in response to nutrient deprivation and in neurodegenerative conditions. One of the proteins critical to this process is Beclin-1, the mammalian orthologue of the yeast autophagy protein Apg6/Vps30. Beclin-1 can complement defects in yeast autophagy caused by loss of Apg6 and can also stimulate autophagy when overexpressed in mammalian cells. Mammalian Beclin-1 was originally isolated in a yeast two-hybrid screen for Bcl-2 interacting proteins and has been shown to interact with Bcl-2 and Bcl-xL, but not with Bax or Bak. While Beclin-1 is generally ubiquitously expressed, research studies have shown it is monoallelically deleted in 40-75% of sporadic human breast and ovarian cancers. Beclin-1 is localized within cytoplasmic structures including the mitochondria, although overexpression of Beclin-1 reveals some nuclear staining and CRM1-dependent nuclear export. Investigators have demonstrated that Beclin-1-/- mice die early in embryogenesis and Beclin-1-/+ mice have a high incidence of spontaneous tumors. Stem cells from the null mice demonstrate an altered autophagic response, although responses to apoptosis appeared normal. Researchers have also found that overexpression of Beclin-1 in virally infected neurons in vivo resulted in significant protection against Sindbis virus-induced disease and neuronal apoptosis.
Product Details
Description Full length Clone DNA of Human beclin 1, autophagy related with C terminal HA tag.
NCBI Ref Seq NM_003766.3
RefSeq ORF Size 1352 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites KpnI + XbaI (6kb + 1.4kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.