Online Inquiry
BCR Knockout Cell Line
SPL-00631
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 41bp deletion |
| Target Information | |
|---|---|
| Target Name | BCR |
| Gene Abbr. | BCR |
| Gene ID | 613 |
| Full Name | BCR activator of RhoGEF and GTPase |
| Alias | ALL, BCR1, CML, D22S11, D22S662 |
| Species | Human |
| Genomic Locus | chr22:23181740 |
| Transcript | NM_004327 |
| WT Expression Level | 8.10 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | A reciprocal translocation between chromosomes 22 and 9 produces the Philadelphia chromosome, which is often found in patients with chronic myelogenous leukemia. The chromosome 22 breakpoint for this translocation is located within the BCR gene. The translocation produces a fusion protein which is encoded by sequence from both BCR and ABL, the gene at the chromosome 9 breakpoint. Although the BCR-ABL fusion protein has been extensively studied, the function of the normal BCR gene product is not clear. The protein has serine/threonine kinase activity and is a GTPase-activating protein for p21rac. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 41bp deletion in a coding exon of BCR. |
| Description | 41bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TACCGCCATTGGCGTCGATC |
| PCR Primer |
Forward: GAAGGTCAACGACAAAGAGGTGTC Reverse: GGAGGTGAGGTTCTCATTGGAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.