Online Inquiry
BCOR Knockout Cell Line
SPL-00630
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 4bp deletion |
| Target Information | |
|---|---|
| Target Name | BCOR |
| Gene Abbr. | BCOR |
| Gene ID | 54880 |
| Full Name | BCL6 corepressor |
| Alias | ANOP2, MAA2, MCOPS2 |
| Species | Human |
| Genomic Locus | chrX:40075152 |
| Transcript | NM_017745 |
| WT Expression Level | 59.83 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene was identified as an interacting corepressor of BCL6, a POZ/zinc finger transcription repressor that is required for germinal center formation and may influence apoptosis. This protein selectively interacts with the POZ domain of BCL6, but not with eight other POZ proteins. Specific class I and II histone deacetylases (HDACs) have been shown to interact with this protein, which suggests a possible link between the two classes of HDACs. Several transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene is found on chromosome Y.[provided by RefSeq, Jun 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of BCOR. |
| Description | 4bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGCACGGCCCATAGGATCGA |
| PCR Primer |
Forward: GTATATAGCACTGAAGCCATTTGGG Reverse: AACCCTTTGTGCTTGGATGTTAAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.