BCOR Knockout Cell Line - CD BioSciences

service-banner

BCOR Knockout Cell Line

BCOR Knockout Cell Line

SPL-00629

Size Price
1 Unit Online Inquiry
Description
2bp deletion
Target Information
Target Name BCOR
Gene Abbr. BCOR
Gene ID 54880
Full Name BCL6 corepressor
Alias ANOP2, MAA2, MCOPS2
Species Human
Genomic Locus chrX:40075152
Transcript NM_017745
WT Expression Level 59.83 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene was identified as an interacting corepressor of BCL6, a POZ/zinc finger transcription repressor that is required for germinal center formation and may influence apoptosis. This protein selectively interacts with the POZ domain of BCL6, but not with eight other POZ proteins. Specific class I and II histone deacetylases (HDACs) have been shown to interact with this protein, which suggests a possible link between the two classes of HDACs. Several transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene is found on chromosome Y.[provided by RefSeq, Jun 2010].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of BCOR.
Description 2bp deletion
Parental Cell Line C631
Guide RNA Sequence AGCACGGCCCATAGGATCGA
PCR Primer Forward: GTATATAGCACTGAAGCCATTTGGG
Reverse: AACCCTTTGTGCTTGGATGTTAAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.