Online Inquiry
BCL6 cDNA ORF Clone, Human, C-HA tag
SPD-01542
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human B-cell CLL/lymphoma 6 with C terminal HA tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Bcl-6 |
Gene Abbr. | BCL6 |
Gene ID | 604 |
Full Name | BCL6 transcription repressor |
Alias | BCL5, BCL6A, LAZ3, ZBTB27, ZNF51 |
Introduction | Chromosomal translocations result in misregulation of the proto-oncogene BCL6 in patients with B cell-derived non-Hodgkin's lymphoma. The BCL6 gene is selectively expressed in mature B cells and encodes a nuclear phosphoprotein that belongs to the BTB/POZ zinc finger family of transcription factors. BCL6 protein can bind to target DNA sequences of Stat6 and, analogous to Stat6, modulate the expression of interleukin-4-induced genes. Furthermore, BCL6 restrains p53-dependent senescence, making BCL6-active tumors functionally p53-negative. The mitogen-activated protein kinases, Erk1 and Erk2, but not JNK, phosphorylate BCL6 at multiple sites. Phosphorylation of BCL6 at Ser333 and Ser343 results in degradation of BCL6 by the ubiquitin/proteasome pathway in B cells. In addition, BCL6 is acetylated and its transcriptional repressor function is inhibited by the transcriptional co-activator p300. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human B-cell CLL/lymphoma 6 with C terminal HA tag. |
NCBI Ref Seq | NM_138931 |
RefSeq ORF Size | 2163 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Restriction Sites | HindIII + NotI (6kb + 2.16kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.