BCL6 cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

BCL6 cDNA ORF Clone, Human, C-FLAG tag

BCL6 cDNA ORF Clone, Human, C-FLAG tag

SPD-01539

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human B-cell CLL/lymphoma 6 with C terminal Flag tag.
Target Information
Species Human
Target Name Bcl-6
Gene Abbr. BCL6
Gene ID 604
Full Name BCL6 transcription repressor
Alias BCL5, BCL6A, LAZ3, ZBTB27, ZNF51
Introduction Chromosomal translocations result in misregulation of the proto-oncogene BCL6 in patients with B cell-derived non-Hodgkin's lymphoma. The BCL6 gene is selectively expressed in mature B cells and encodes a nuclear phosphoprotein that belongs to the BTB/POZ zinc finger family of transcription factors. BCL6 protein can bind to target DNA sequences of Stat6 and, analogous to Stat6, modulate the expression of interleukin-4-induced genes. Furthermore, BCL6 restrains p53-dependent senescence, making BCL6-active tumors functionally p53-negative. The mitogen-activated protein kinases, Erk1 and Erk2, but not JNK, phosphorylate BCL6 at multiple sites. Phosphorylation of BCL6 at Ser333 and Ser343 results in degradation of BCL6 by the ubiquitin/proteasome pathway in B cells. In addition, BCL6 is acetylated and its transcriptional repressor function is inhibited by the transcriptional co-activator p300.
Product Details
Description Full length Clone DNA of Human B-cell CLL/lymphoma 6 with C terminal Flag tag.
NCBI Ref Seq NM_138931
RefSeq ORF Size 2121 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + NotI (6kb + 2.16kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.