BCL2L2 Knockout Cell Line - CD BioSciences

service-banner

BCL2L2 Knockout Cell Line

BCL2L2 Knockout Cell Line

SPL-00626

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name BCL2L2
Gene Abbr. BCL2L2
Gene ID 599
Full Name BCL2 like 2
Alias BCL-W, BCL2-L-2, BCLW, PPP1R51
Species Human
Genomic Locus chr14:23307887
Transcript NM_004050
WT Expression Level 36.29 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the BCL-2 protein family. The proteins of this family form hetero- or homodimers and act as anti- and pro-apoptotic regulators. Expression of this gene in cells has been shown to contribute to reduced cell apoptosis under cytotoxic conditions. Studies of the related gene in mice indicated a role in the survival of NGF- and BDNF-dependent neurons. Mutation and knockout studies of the mouse gene demonstrated an essential role in adult spermatogenesis. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream PABPN1 (poly(A) binding protein, nuclear 1) gene. [provided by RefSeq, Dec 2010].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of BCL2L2.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence CCCGCTGCACCAAGCCATGC
PCR Primer Forward: AAGTGCTCCTTCTGATTCTCTCTTC
Reverse: CTTGAAAAAGTTCATCGGAGACCTG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.