BCL2L11 cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

BCL2L11 cDNA ORF Clone, Human, C-FLAG tag

BCL2L11 cDNA ORF Clone, Human, C-FLAG tag

SPD-01605

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human BCL2-like 11 (apoptosis facilitator) with C terminal Flag tag.
Target Information
Species Human
Target Name BIM
Gene Abbr. BCL2L11
Gene ID 10018
Full Name BCL2 like 11
Alias BAM, BIM, BOD
Introduction Bim/Bod is a pro-apoptotic protein belonging to the BH3-only group of Bcl-2 family members including Bad, Bid, Bik, Hrk, and Noxa that contain a BH3 domain but lack other conserved BH1 or BH2 domains. Bim induces apoptosis by binding to and antagonizing anti-apoptotic members of the Bcl-2 family. Interactions have been observed with Bcl-2, Bcl-xL, Mcl-1, Bcl-w, Bfl-1, and BHRF-1. Bim functions in regulating apoptosis associated with thymocyte negative selection and following growth factor withdrawal, during which Bim expression is elevated. Three major isoforms of Bim are generated by alternative splicing: BimEL, BimL, and BimS. The shortest form, BimS, is the most cytotoxic and is generally only transiently expressed during apoptosis. The BimEL and BimL isoforms may be sequestered to the dynein motor complex through an interaction with the dynein light chain and released from this complex during apoptosis. Apoptotic activity of these longer isoforms may be regulated by phosphorylation. Environmental stress triggers Bim phosphorylation by JNK and results in its dissociation from the dynein complex and increased apoptotic activity.
Product Details
Description Full length Clone DNA of Human BCL2-like 11 (apoptosis facilitator) with C terminal Flag tag.
NCBI Ref Seq BC033694
RefSeq ORF Size 597 bp
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.