Online Inquiry
Bcl2l1 cDNA ORF Clone, Mouse, C-HA tag
SPD-01552
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse BCL2-like 1 with C terminal HA tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | Bcl-xL |
Gene Abbr. | Bcl2l1 |
Gene ID | 12048 |
Full Name | BCL2-like 1 |
Alias | Bcl, Bcl(X, Bcl(X)L, Bcl-XL, Bcl2l |
Introduction | Bcl-xL prevents apoptosis through two different mechanisms: heterodimerization with an apoptotic protein inhibits its apoptotic effect and formation of mitochondrial outer membrane pores help maintain a normal membrane state under stressful conditions. Bcl-xL is phosphorylated by JNK following treatment with microtubule-damaging agents such as paclitaxel, vinblastine and nocodazole. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse BCL2-like 1 with C terminal HA tag. |
NCBI Ref Seq | NM_009743.4 |
RefSeq ORF Size | 702 bp |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.