BCL2L1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

BCL2L1 cDNA ORF Clone, Human, untagged

BCL2L1 cDNA ORF Clone, Human, untagged

SPD-01568

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human BCL2-like 1.
Target Information
Species Human
Target Name Bcl-xL
Gene Abbr. BCL2L1
Gene ID 598
Full Name BCL2 like 1
Alias BCL-XL/S, BCL2L, BCLX, Bcl-X, PPP1R52
Introduction Bcl-xL prevents apoptosis through two different mechanisms: heterodimerization with an apoptotic protein inhibits its apoptotic effect and formation of mitochondrial outer membrane pores help maintain a normal membrane state under stressful conditions. Bcl-xL is phosphorylated by JNK following treatment with microtubule-damaging agents such as paclitaxel, vinblastine and nocodazole.
Product Details
Description Full length Clone DNA of Human BCL2-like 1.
NCBI Ref Seq NM_138578.1
RefSeq ORF Size 702 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI (two restriction sites) + XbaI (6.1kb + 0.4kb + 0.3kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.