Online Inquiry
Bcl2a1a cDNA ORF Clone, Mouse, C-FLAG tag
SPD-00256
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse B-cell leukemia/lymphoma 2 related protein A1a with C terminal Flag tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | A1/Bfl-1 |
Gene Abbr. | Bcl2a1a |
Gene ID | 12044 |
Full Name | B cell leukemia/lymphoma 2 related protein A1a |
Alias | A, A1, BB218357, Bcl2, Bcl2a1 |
Introduction | The Bcl-2-related protein A1 (Bfl-1, BCL2A1) is an anti-apoptotic member of the Bcl-2 family originally cloned from mouse bone marrow as a granulocyte macrophage-colony stimulating factor (GM-CSF)-inducible gene. Expression of A1/Bfl-1 is primarily restricted to hematopoietic cells, although it has been detected in some non-hematopoietic tissues including lung and in endothelial cells. A1/Bfl-1 protein is rapidly induced by NF-κB and is elevated in response to a variety of factors that stimulate this pathway, including TNF-α and IL-1β, CD40, phorbol ester, and LPS. As with other Bcl-2 family proteins, A1/Bfl-1 functions by binding and antagonizing pro-apoptotic members of the family (Bid, Bim), which inhibits release of mitochondrial cytochrome c. In contrast, research studies indicate that the enzyme calpain cleaves A1/Bfl-1 at specific sites within the amino terminal region, creating pro-apoptotic, carboxy-terminal fragments that promote mitochondrial release of cytochrome c and apoptosis. Studies suggest a possible therapeutic strategy of targeting apoptosis through use of the specific A1/Bfl-1 cleavage fragments. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse B-cell leukemia/lymphoma 2 related protein A1a with C terminal Flag tag. |
NCBI Ref Seq | NM_009742.3 |
RefSeq ORF Size | 519 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | HindIII + XbaI (6kb + 0.56kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.