Bcl2a1a cDNA ORF Clone, Mouse, C-FLAG tag - CD BioSciences

service-banner

Bcl2a1a cDNA ORF Clone, Mouse, C-FLAG tag

Bcl2a1a cDNA ORF Clone, Mouse, C-FLAG tag

SPD-00256

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse B-cell leukemia/lymphoma 2 related protein A1a with C terminal Flag tag.
Target Information
Species Mouse
Target Name A1/Bfl-1
Gene Abbr. Bcl2a1a
Gene ID 12044
Full Name B cell leukemia/lymphoma 2 related protein A1a
Alias A, A1, BB218357, Bcl2, Bcl2a1
Introduction The Bcl-2-related protein A1 (Bfl-1, BCL2A1) is an anti-apoptotic member of the Bcl-2 family originally cloned from mouse bone marrow as a granulocyte macrophage-colony stimulating factor (GM-CSF)-inducible gene. Expression of A1/Bfl-1 is primarily restricted to hematopoietic cells, although it has been detected in some non-hematopoietic tissues including lung and in endothelial cells. A1/Bfl-1 protein is rapidly induced by NF-κB and is elevated in response to a variety of factors that stimulate this pathway, including TNF-α and IL-1β, CD40, phorbol ester, and LPS. As with other Bcl-2 family proteins, A1/Bfl-1 functions by binding and antagonizing pro-apoptotic members of the family (Bid, Bim), which inhibits release of mitochondrial cytochrome c. In contrast, research studies indicate that the enzyme calpain cleaves A1/Bfl-1 at specific sites within the amino terminal region, creating pro-apoptotic, carboxy-terminal fragments that promote mitochondrial release of cytochrome c and apoptosis. Studies suggest a possible therapeutic strategy of targeting apoptosis through use of the specific A1/Bfl-1 cleavage fragments.
Product Details
Description Full length Clone DNA of Mouse B-cell leukemia/lymphoma 2 related protein A1a with C terminal Flag tag.
NCBI Ref Seq NM_009742.3
RefSeq ORF Size 519 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites HindIII + XbaI (6kb + 0.56kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.

We use cookies to understand how you use our site and to improve the overall user experience. This includes personalizing content and advertising. Read our Privacy Policy

Accept Cookies
x