Online Inquiry
BCL2A1 cDNA ORF Clone, Human, C-His tag
SPD-00247
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human BCL2-related protein A1,transcript variant 1 with C terminal His tag. |
Target Information | |
---|---|
Species | Human |
Target Name | A1/Bfl-1 |
Gene Abbr. | BCL2A1 |
Gene ID | 597 |
Full Name | BCL2 related protein A1 |
Alias | ACC-1, ACC-2, ACC1, ACC2, BCL2L5 |
Introduction | The Bcl-2-related protein A1 (Bfl-1, BCL2A1) is an anti-apoptotic member of the Bcl-2 family originally cloned from mouse bone marrow as a granulocyte macrophage-colony stimulating factor (GM-CSF)-inducible gene. Expression of A1/Bfl-1 is primarily restricted to hematopoietic cells, although it has been detected in some non-hematopoietic tissues including lung and in endothelial cells. A1/Bfl-1 protein is rapidly induced by NF-κB and is elevated in response to a variety of factors that stimulate this pathway, including TNF-α and IL-1β, CD40, phorbol ester, and LPS. As with other Bcl-2 family proteins, A1/Bfl-1 functions by binding and antagonizing pro-apoptotic members of the family (Bid, Bim), which inhibits release of mitochondrial cytochrome c. In contrast, research studies indicate that the enzyme calpain cleaves A1/Bfl-1 at specific sites within the amino terminal region, creating pro-apoptotic, carboxy-terminal fragments that promote mitochondrial release of cytochrome c and apoptosis. Studies suggest a possible therapeutic strategy of targeting apoptosis through use of the specific A1/Bfl-1 cleavage fragments. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human BCL2-related protein A1,transcript variant 1 with C terminal His tag. |
NCBI Ref Seq | NM_004049.3 |
RefSeq ORF Size | 528 bp |
Vector | pCMV3-C-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.