BCL2 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

BCL2 cDNA ORF Clone, Human, untagged

BCL2 cDNA ORF Clone, Human, untagged

SPD-01538

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human B-cell CLL/lymphoma 2, nuclear gene encoding mitochondrial protein, transcript variant alpha.
Target Information
Species Human
Target Name Bcl-2
Gene Abbr. BCL2
Gene ID 596
Full Name BCL2 apoptosis regulator
Alias Bcl-2, PPP1R50
Introduction Bcl-2 exerts a survival function in response to a wide range of apoptotic stimuli through inhibition of mitochondrial cytochrome c release. It has been implicated in modulating mitochondrial calcium homeostasis and proton flux. Several phosphorylation sites have been identified within Bcl-2 including Thr56, Ser70, Thr74, and Ser87. It has been suggested that these phosphorylation sites may be targets of the ASK1/MKK7/JNK1 pathway and that phosphorylation of Bcl-2 may be a marker for mitotic events. Mutation of Bcl-2 at Thr56 or Ser87 inhibits its anti-apoptotic activity during glucocorticoid-induced apoptosis of T lymphocytes. Interleukin-3 and JNK-induced Bcl-2 phosphorylation at Ser70 may be required for its enhanced anti-apoptotic functions.
Product Details
Description Full length Clone DNA of Human B-cell CLL/lymphoma 2, nuclear gene encoding mitochondrial protein, transcript variant alpha.
NCBI Ref Seq NM_000633.2
RefSeq ORF Size 720 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.72kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.